Twist Bioscience

AATGAGGTCGAGAGAGGTCAGAATAATGCGGGTATTGTCGAGTACCAGGTAGTACCCTGAAATGAGGTCGAGAGAGGTCAGAATAATGCGCTGGAGACTTACCAGGTAGATCAGTGGAATTGAAATGAGGTCGAGAGAGGTCAGAATAATGCGAGGGTCAATGCGAGACAGGTAAATGATGCGAATGATGATGAGTCCGAGAGAACTTACCAGGTA Twist Bioscience

Goodbye March, and hello Spring! We've bundled all of our best March news into one spot for you here. Read about everything from our new codon optimization tool to recent competitions (Bits to Binders and Bio x AI Hackathon), and hot-off-the-press publications. Also, learn how our CEO is "driving the San Francisco Bay area forward."

Now on demand! If you missed last week’s webinar, never fear, we have you covered. Watch it on demand here: https://lnkd.in/gi2mkVNn Find the details of the special promo mentioned in the webinar here: https://lnkd.in/g3WtdMXA Twist Bioscience, Gene by Gene

Practical NGS workflows for AgBio research! At this year’s Plant and Animal Genome Conference (PAG), researchers and Twist scientists shared new data showing how high-throughput NGS workflows can simplify genotyping across crops and livestock. Check out the two posters: • “Development of an optimized hybrid capture system for target enrichment of bovine samples” Demonstrates a scalable genotyping workflow powered by FlexPrep, the Twist Genotyping Panel - Bovine 100k, and Bovine Blockers: https://lnkd.in/g3X5i69d • “High-throughput genotyping of plant and animal tissues with FlexPrep™” Showcases high-quality genotyping data generated from an ultra-high throughput workflow using a novel purification method: https://lnkd.in/gYuHPsn6 Together, these posters demonstrate how optimized extraction, library preparation, and targeted sequencing can deliver reliable genotyping data. Twist Bioscience

Access unparalleled sequence space for your complex screening projects. Our Gene Pools are a revolution in pooled DNA synthesis. Access thousands of bespoke Gene sequences up to 1.8kb, pooled together, with 0% chimera rates and <1% dropout*. This massive increase in length and quality allows you to: ✅ Unlock sequence space that was previously unscreenable ✅ Enable more complex and comprehensive experimental designs Move beyond standard designs and use this unprecedented access to unlimited DNA for your next screen: https://lnkd.in/gH4ffm3H Twist Bioscience, *For research use only. Not for diagnostic purposes. Dropout rate refers specifically to accepted sequences. Of fragments accepted in fiscal year 2025, >99% were shipped.

Are you generating proteins in your research, and are looking to maximize expression? If so then Twist’s AI-driven codon optimization tool will be your new favorite addition to your workflow. Common limitations of “Rules-Based” codon optimization ❌Optimization of codons is not performed in a sequence-wide context ❌Optimization omits “hidden” information, e.g. mRNA stability ❌Optimization can take a long time for projects with multiple sequences Why you should try Twist’s new AI-driven codon optimization ✅Driven by a large language model trained on millions of DNA-protein pairs ✅Balances hidden variables across the sequence, not just codon usage ✅Can optimize hundreds of sequences in a matter of seconds Try it now: https://lnkd.in/gfmk9E5v

Advances in AI for protein design are opening new frontiers in biology. At the same time, new capabilities can pose challenges to long-standing approaches to biosecurity. Biosecurity screening today relies largely on protein sequence similarity to known threats. But emerging design capabilities may produce biologically active molecules that don’t resemble anything we’ve seen before. In a new perspective article, we explore challenges and opportunities with moving toward function-based screening, focusing on what a sequence can do, not just what it looks like: "Beyond Sequence Similarity: Toward Function-Based Screening of Nucleic Acid Synthesis" https://lnkd.in/gPmy5Eya Twist Bioscience Aclid Microsoft Microsoft Research International Biosecurity and Biosafety Initiative for Science (IBBIS) RAND Bulletin of the Atomic Scientists Radical Numerics NTI U.S. Department of Homeland Security

A very early morning and very late night were well worth it to be part of the Berlin Bio x AI Hackathon! 🧬 x 🤖 Teams from across Europe spent 24 hours (and through the night) brute-forcing, hacking, modeling, and building agentic LLMs. Solving real computational and conceptual challenges across 3 categories from protein design, genome modeling & synthesis, and agentic AI in life sciences. We loved sharing how we support the biological continuum from discovery through application, from DNA synthesis and protein expression to NGS to biologics, and hearing about the work you are driving forward. Events like this are exactly where partnerships start, where ideas find customers, and where the next breakthrough is born. We are thrilled to be part of the fun. Big thanks to the team Dr. Eric Dyrcz, Julian Jude, PhD, Manuel Delpero, PhD, and Gemma Brils García. Congratulations to all the participants and winners! 🏆 Twist Bioscience, Nucleate Germany

👀 👀 Look who is on this list of “Biotech Founders Driving the San Francisco Bay Area Forward in 2026!” Congratulations Emily Leproust! We’re super proud of our CEO and co-founder Emily Leproust for being one “of the most notable biotech leaders in the Bay Area, operating at the intersection of scientific ambition and real-world traction.” Read the article in the San Francisco Tribune here: https://lnkd.in/gCcrA3Rb Twist Bioscience

🧬 Exciting News: Introducing the Biodesign Challenge Prize for DNA Futures! We are thrilled to announce a brand-new prize category: the Biodesign Challenge Prize for DNA Futures, proudly supported by our incredible partner, Twist Bioscience. ABOUT THE BIODESIGN CHALLENGE PRIZE FOR DNA FUTURES: The genetic revolution is reshaping our world. From reading and editing to writing and manipulating DNA, biotechnology is unlocking possibilities once confined to science fiction — in personalized medicine, environmental conservation, agricultural science, and far beyond. This prize celebrates the bold creativity of the next generation of biodesigners who are daring to imagine what comes next. 🏆 The Biodesign Challenge Prize for DNA Futures honors the team that best investigates and creatively envisions how DNA, genomics, and related biotechnologies could shape tomorrow's world. We're looking for projects that: • Explore speculative futures powered by genetic innovation • Propose novel applications of DNA-based design • Critically reflect on the role of DNA in society, culture, and ethics Special consideration will be given to projects that explore how synthetic DNA and genomic tools can improve diagnostics, expand research capabilities, and lead to better health outcomes. We are proud to partner with Twist Bioscience, global leaders in DNA synthesis innovation, to make this prize possible. Together with Twist Bioscience, we support emerging biodesigners in asking deeper questions about the futures we are building—and the values embedded within them. 🔗 Learn more about Twist Bioscience and how they're writing the future: https://lnkd.in/gmETxPg Are you ready to design the future of DNA? 🌍🧬 #BiodesignChallenge #DNAFutures #TwistBioscience #Biodesign #SyntheticBiology #Biotechnology #GenomicInnovation #FutureOfScience #DNASynthesis